FOTOSÍNTESIS 2018 A. FASE LUMINOSA


Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "FOTOSÍNTESIS 2018 A. FASE LUMINOSA"

Transcripción

1 FOTOSÍNTESIS 2018 A. FASE LUMINOSA 1. Responda con V o F La luz azul es más energética que la amarilla. Las plantas son verdes porque la clorofila absorbe y utiliza la luz verde. En la mayoría de los organismos fotosintéticos el último aceptor de electrones es el CO 2. Todos los fotótrofos llevan a cabo la fotosíntesis en una organela especializada, el cloroplasto. Cuando existe flujo de electrones lineal en las plantas los e - del O 2 se utilizan finalmente para reducir al NADP I) El herbicida 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU o diuron) es un inhibidor de la fotosíntesis debido a que compite por el sitio de unión de uno de los componentes de la cadena. La figura muestra el perfil de evolución de O 2 y fotofosforilación de cloroplastos tratados con DCMU. Al tiempo 1 a los cloroplastos se les agregó el Reactivo de Hill (Fe(CN) 6 K 3 ), un aceptor alternativo de electrones del fotosistema II. a) En base a la estructura del DCMU y a estos resultados de la figura, sugiera el sitio en la cadena fotosintética donde estaría actuando el DCMU. b) Cuál será el estado redox de los demás componentes de la cadena en presencia de DCMU? c) Al tiempo 2 se agregó metilamina a la suspensión con DCMU; en base a los resultados dónde actúa este inhibidor? DCMU 3. Una muestra de 0,15 ml de una suspensión de membranas tilacoides (con una concentración de clorofila de 2 mg/ml) se agregó a 2,85 ml de una solución tamponada conteniendo un aceptor artificial de electrones del fotosistema I. La mezcla se incubó con luz roja, a una intensidad saturante, y la producción de O 2, medida con un electrodo, se muestra en el gráfico. a) Calcule la velocidad de producción de O 2 (en µmol/min.mg de clorofila en cada caso). b) Calcule el índice P/2e - c) Caracterice lo más posible a los compuestos X, Y y Z. d) Finalmente, se agregaron 100 µl de una solución 5 mm de un compuesto H capaz de ceder electrones a la plastocianina. Cuál sería la naturaleza de H? Explique de que forma evolucionaría la velocidad de producción de O 2, síntesis de ATP y reducción del aceptor alternativo luego del agregado del mismo. 0

2 0.30 H ul Z 1 µl Y [O 2 ] (mm) µl X 0.22 LUZ 6 µl ADP 25 mm + 3 µl Pi 100 mm Tiempo (min) B. FIJACIÓN DEL CARBONO 1. Ud. quiere analizar la compartamentalización de las reacciones fotosintéticas en una planta C 3. Para ello somete una suspensión de células de dicha planta a un pulso de 14 CO 2 en presencia de luz. Luego, rompe las células y mediante un protocolo de centrifugación obtiene dos fracciones, una correspondiente al sobrenadante (SN1) y otra al pellet (fracción cloroplástica, CP1). Para tener un duplicado repite todo el procedimiento obteniendo nuevamente dos fracciones (SN2 y CP2). A continuación realiza los siguientes ensayos: I) Determinación de clorofila mediante extracción con acetona: blanco SN1(1µl) CP1(1µl) SN2(1µl) CP2(1µl) Abs 660nm 0,001 0,103 0,304 0,008 0,287 II) Gel de poliacrilamida con SDS teñido con Coomassie: SN1 CP1 SN2 CP2 RuBisCO III) Identificación de los compuestos marcados con 14 C. a) Explique los resultados obtenidos en el ensayo II teniendo en cuenta también los resultados del ensayo I. b) Qué preparaciones elegiría para realizar el ensayo III? c) Indique los intermediarios de qué vías metabólicas aparecerán marcados en ambas fracciones. Justifique. 2. Se aislan protoplastos de una planta C 3 en un medio isosmótico y luego se iluminan en presencia de 14 CO 2. A continuación se separa el sobrenadante de la fracción cloroplástica. a) Explique qué 1

3 compuesto/s de la fracción cloroplástica puede/n aparecer marcados. b) Qué compuesto/s de la fracción sobrenadante puede/n aparecer marcados? Por qué? c) Calcule la energía (en forma de moléculas de ATP) y el poder reductor (en forma de moléculas de NADPH) necesarios para sintetizar una molécula de sacarosa. Considere que la sacarosa se sintetiza a partir de las siguientes reacciones: UDP-glucosa + fructosa-6-p sacarosa-6-p + UDP (sacarosa P sintasa) Sacarosa-6-P sacarosa + P (sacarosa fosfatasa) 3. Una planta con metabolismo fotosintético C 3 es crecida bajo luz y condiciones de elevada concentración de CO 2 (figura). Luego es transferida a una cámara donde la relación O 2 /CO 2 es similar a la ambiental con una temperatura de 25 C. Finalmente, la temperatura de esta cámara es incrementada a 40 C. Durante estos ensayos se midieron la concentración de 3-fosfoglicerato y de un ácido orgánico de dos átomos de carbono (X). a) Explique el perfil de acumulación de estos compuestos señalando la naturaleza de X. 2

4 ÁCIDOS NUCLEICOS 2018 ESTRUCTURA Y FUNCIÓN DE LOS ÁCIDOS NUCLEICOS 1. Cuál es la secuencia de bases de la cadena de ADN complementaria al siguiente fragmento: 5 TGATCAGGTCGACAA 3? Estime su peso molecular. 2. Escriba en fórmulas los siguientes oligonucleótidos, indicando las uniones químicas que participan: pcpgpu y pdapdcpdt. Indique cuáles serían otras posibles formas de anotar los oligonucléotidos mencionados. 3. En muestras de ADN aislados de dos especies de bacterias no identificadas, la adenina representa el 32% y el 17% del total de bases, respectivamente. Qué proporciones relativas de A, G, C y T esperaría encontrar en las dos muestras de ADN? Una de las bacterias fue aislada de una vertiente caliente (64 C) podría decir qué ADN proviene de esta bacteria? Fundamente su respuesta. 4. Watson y Crick predijeron el modo semiconservativo de la replicación partiendo de las reglas de apareamiento de bases de la doble hélice. Posteriormente Meselson y Stahl probaron esta predicción utilizando células de Escherichia coli con ADN marcado isotópicamente a las que se les permitía replicar su ADN a partir de precursores no marcados y analizando la distribución del isótopo en las moléculas de ADN hijas después de 1, 2 y 3 generaciones. Meselson y Stahl emplearon el isótopo pesado de nitrógeno ( 15 N) como marca de densidad para el ADN y utilizaron la sedimentación por equilibrio en solución de CsCl para separar el ADN totalmente sustituido con 15 N del semisustituido ( 14 N- 15 N) y el ADN no sustituido ( 14 N). Si se cultiva E. coli (originalmente marcada con 15 N) en un medio con 14 N por tres generaciones (un aumento de ocho veces en población), cuál de las siguientes distribuciones de ADN entre las tres clases mayores de densidad esperaría encontrar después de la extracción del ADN? 15 N 15 N- 14 N 14 N a) 1/8 1/8 6/8 b) 1/8 0 7/8 c) 0 1/8 7/8 d) 0 2/8 6/8 e) 0 4/8 4/8 5. Los dibujos siguientes representan el patrón de ultracentrifugación en gradiente de densidad del ADN celular obtenido en el experimento de Meselson-Stahl. a) Indique cuál de los patrones anteriores corresponden al patrón de gradiente de densidad obtenido en la 1, 2 y 3º generación de células en el experimento realizado por Meselson-Stahl? 3

5 b) Indique cuáles serían los patrones obtenidos para las 1º y 2º generaciones de células si el modo de replicación fuera conservativo. Para cada caso describa las proporciones relativas de cada tipo de DNA que estaría presente en el extracto. 6. La estructura de doble hélice del ADN se pierde por calentamiento. La transición desde la hélice al desorden tiene lugar en un rango estrecho de temperatura, lo que sugiere que el proceso es cooperativo. La temperatura al punto medio de transición es llamada Temperatura de fusión (T f ). Para varias moléculas de ADN hay una relación lineal entre T f y la fracción molar de G C (f GC ). En NaCl 0,2 M esta relación es: T f ( C)= 69, f GC a) Proponga la base estructural para la dependencia de la T f sobre f GC b) Ordene las siguientes moléculas de ADN según su temperatura de fusión: A) AAGTTCTCTGAA TTCAAGAGACTT B) AGTCGTCAATGCAG TCAGCAGTTACGTC C) GCACCTCTCAGG CCTGGAGAGTCC 7. Una solución de ADN de doble hebra se calienta y luego se enfría a temperatura ambiente durante un intervalo de dos minutos. Cómo cambiará la absorbancia a 260 nm durante el enfriamiento si: a) la solución se calentó por encima de la T f? b) la solución se calentó por debajo de la T f? 8. Describa las técnicas más comunes de separación en geles de moléculas de ADN y de ARN. Cómo se pueden visualizar estas moléculas en los geles? Cómo se determina el peso molecular de un fragmento de ADN corrido en un gel? 9. Ud purifica en su laboratorio ARN de hojas de maíz. Con el fin de analizar la concentración y la pureza de la muestra, la somete a medidas de absorbancia a 260 y 280 nm obteniendo valores de absorbancia de 0,4 y 0,199, respectivamente. Estime su concentración y que puede decir de su pureza. Posteriormente, cuando visualiza la muestra en un gel de electroforesis encuentra que la muestra contiene ARN y ADN genómico. Qué tipo de contaminación presenta la muestra?. Esquematice la imagen del gel de electroforesis de la muestra. Cómo se visualizaría la muestra en un gel de electroforesis si la muestra es tratada previamente con NaOH 5N. Cómo procedería experimentalmente para aislar ARN libre de ADN. Cómo procedería para aislar ADN libre de ARN. 10. a) Suponga que desea marcar radioactivamente de manera selectiva el ADN (es decir, sin marcar el ARN) de células bacterianas en división, qué molécula radioactiva añadiría al medio de cultivo? b) Ud. desea preparar un ADN con sus átomos de fósforo estructural marcado uniformemente con 32 P, qué precursor radioactivo debería añadir a la solución? Señale la posición de los átomos radioactivos. 11. El fragmento de ADN con la siguiente secuencia fue tratada con una ADN polimerasa, utilizando el cebador marcado de manera fluorescente (*) y con cada una de las mezclas de 4

6 nucleótidos indicadas a continuación. Los didesoxinucleótidos fueron añadidos en cantidades relativamente pequeñas (ddntp): a) datp, dttp, dctp, dgtp, ddttp (se muestra en el gel); b) datp, dttp, dctp, dgtp, ddgtp; c) datp, dctp, dgtp, ddttp; d) datp, dttp, dctp, dgtp. El asterisco representa un marcador fluorescente en el cebador indicado: *5 AGCCCTGTAA3 3 TCGGGACATTATTACGCAAGGACATTAGAC 5 El ADN resultante fue separado por electroforesis en gel de poliacrilamida y las bandas fluorescentes localizadas. Se muestra el patrón de bandas obtenida con la mezcla de nucleótidos Suponiendo que todas las mezclas fuesen analizadas en el mismo gel a) Qué apariencia tendrían los restantes carriles? Explique. 12. Represente una estructura típica del ARN de transferencia. Destaque las estructuras más relevantes. Indique qué tipo de bases puede encontrar además de las 4 más comunes. Sugiera el propósito de las bases inusuales. Para investigar y aprender En el siguiente enlace encontrarán algunos de los experimentos que llevaron a descubrir que el ADN era la molécula responsable de la herencia genética. transformación En este enlace hallarán el artículo original publicado por Watson y Crick en 1953, Nature 171: pp Si les interesa conocer algo acerca de las contribuciones de Rosalind Franklin a la elucidación de la estructura del ADN y pensar por qué no ha sido debidamente reconocida, pueden comenzar leyendo el siguiente enlace 5

SitemapDr. Hollywood: Uma Receita de Amor Legendado Online Assistir Dr. Hollywood: Uma Receita de Amor Legendado Online HD 720p Benjamin Stone (Michael J. Fox) é um jovem médico que quer conseguir emprego como cirurgião plástico em Los Angeles. No caminho para a cidade ele se envolve em um acidente, que derruba uma cerca em uma pequena cidade. Infelizmente o dono da cerca é o juiz local, que o condena ... | IMDb: 7 99,918 S1E22 Grimm - Season 1 | Che.Cosa.Aspettarsi.Quando.Si.Aspetta.2012.iTALiAN.AC3.BRRip.XviD-T4P3